grain_icon Markers Home | Markers Search | Browse Map Sets | SSR Markers Resource | Help | Tutorial | FAQs

SSRIT - Simple Sequence Repeat Identification Tool

This tool finds all perfect simple sequence repeats (SSRs) in a given sequence.

For source code for a stand-alone version please click here.

For citation, please use this reference Temnykh et al. (2001).

Note: Netscape 2.0 or greater, or IE 4.0 or greater required.


1) Select search parameters

a) Select the maximum motif-length group you wish to find. For example, if you want to search for all SSRs up to and including pentamers (meaning, you'd like to search for dimers, trimers, tetramers, and pentamers), you should select 'pentamer' from the drop-down menu.

b) Enter the minimum number of repeats you will allow. Entering a '5,' for example, will match SSRs with five or more motif repeats, such as ag-5 ('agagagagag').


2) Paste/Enter your sequence of interest into the textarea

The sequence(s) must be in FASTA format - meaning, there must be a title line with a '>' at the beginning for each sequence.

FOR EXAMPLE,

>seq1
agagattaggatcgatcgcgctctctctctctctctcgatcgagatcgat
ggccatcatcatcatcatcattgagatatagcgcgatatcgagagatctc
agaatagatatcgcgctatagagagatcgagagagagtaga
>seq2
agagataggaatatgagatagcgggggggggggggcgctatacgcgctcg
gagagagatctctctctctcttatagagatcgatcgactagctagatata
agactcactcactcactcactcactcagcgcgat


Paste/Enter your sequence(s) here:



Last modified: Thu Jul 28 13:56:19 EDT 2005